Skip to main content

First report on the molecular phylogenetics and population genetics of Aedes aegypti in Iran

Abstract

Background

Aedes aegypti, the primary vector of various human arboviral diseases, is a significant public health threat. Aedes aegypti was detected in Iran in 2018, in Hormozgan province, but comprehensive information regarding its genetic diversity and origin within the country remains scarce. This study aimed to determine the origin and genetic diversity of Ae. aegypti in southern Iran.

Methods

Aedes aegypti mosquitoes were collected from Bandar Abbas City, Hormozgan Province, southern Iran, between May and July 2022. Specimens were morphologically identified. Origin and assess genetic diversity were assessed based on the mitochondrial DNA-encoded cytochrome c oxidase subunit I (mtDNA-COI) gene.

Results

BLAST (basic local alignment search tool) analysis confirmed the accuracy of the morphological identification of all specimens as Ae. aegypti, with 100% similarity to GenBank sequences. Calculated variance and haplotype diversity were 0.502 and 0.00157, respectively. Among the 604 examined nucleotide sequences, only a single site was non-synonymous. Total nucleotide diversity and average pairwise nucleotides were determined as 0.00083 and 0.502, respectively. Fu and Li's D test values were not statistically significant. Strobeck’s S statistic value was 0.487, and Tajima’s D value was 1.53395; both were not statistically significant (P > 0.10).

Conclusions

Phylogenetic analysis revealed two distinct clades with minimal nucleotide differences and low haplotype diversity, suggesting the recent establishment of Ae. Aegypti in the southern region of Iran. The phylogenetic analysis also indicated an association between Ae. aegypti populations and mosquitoes from Saudi Arabia and Pakistan.

Graphical Abstract

Background

Female Aedes aegypti mosquitoes blood-feed on mammalian hosts, but they exhibit a strong preference for humans over alternative hosts, making them a significant vector of medically important arboviral pathogens, such as dengue fever virus (DENV), Zika virus (ZIKV), chikungunya (CHIKV) and West Nile virus (WNV) [1,2,3,4]. The widespread prevalence of Ae. aegypti across diverse continents therefore represents a significant health threat to millions of people around the world [5, 6]. The close association between Ae. aegypti and humans, particularly in tropical and subtropical regions, has resulted in this species being a primary vector for the indiscriminate spread of arbovirus diseases.

Aedes aegypti originated in Africa and likely dispersed to other continents through sea trade and air travel [7]. Genetic analyses indicate notable distinctions between African Ae. aegypti mosquito populations and those found on other continents. Two subspecies of Ae. aegypti are formally recognized: Ae. aegypti formosus, which has a relatively darker body color, is primarily found in Africa, and Ae. aegypti aegypti, which has a relatively lighter body color, is prevalent on the continents of Asia, Europe and the Americas [8, 9]. Aedes aegypti aegypti has an affinity for human blood and has been widely disseminated in tropical and subtropical regions globally by human activity [10], while the ancestral forms of the sub-Saharan African species Ae. aegypti formosus have been discovered in forested areas where they primarily feed on small mammals [11]. The species breeds most commonly in artificial containers, but also in tree holes, and is predominantly found indoors.

The movement of populations, goods and animals between Iran and other countries where Aedes-borne diseases are persistent has provided numerous opportunities for the transmission and spread of arboviral diseases caused by DENV, CHIKV and WNV within Iran [12, 13]. In Iran, the seroprevalence of CHIKV in the human population was detected in earlier studies, providing evidence of mosquito infection with CHIKV originating from Iran [14, 15]. DENV is considered to be the most significant arbovirus transmitted among humans by Aedes mosquitoes [10]. The majority of human cases have been documented in southeastern Iran, near the border with Pakistan, with no evidence of viral RNA presence in mosquitoes [15]. To date, there is no documented evidence for the occurrences of ZIKV and YFV in Iran [16]. In contrast, WNV transmission is frequently reported across various regions in Iran [17, 18]. Previous studies have indicated that both humans and horses serve as common vertebrate hosts for WNV in Iran [19, 20]. Notably, a study identified three encephalitis patients who tested positive for WNV, with 1.3% of humans and 2.8% of horses found to have positive serological sera [21]. WNV was also identified in mosquitoes such as Aedes caspius and Culex pipiens found in both northern and southern regions of Iran [13, 21, 22].

Molecular methods are currently widely used to investigate the origin and pathways of alien species, gene flow patterns and the genetic composition of specific populations [23, 24]. Genetic diversity within mosquito populations, notably Ae. aegypti, remains critical in terms of their adaptation to environmental conditions [25]. Accurate insights into the genetic diversity of Ae. aegypti populations in specific regions is essential for devising mosquito control strategies. Consequently, genetic diversity studies on vector mosquito populations, particularly Ae. aegypti populations, can provide valuable insights into the pathways of pathogen transmission, leading to more effective disease vector control strategies and providing crucial information for application in control measures against these diseases. Such studies also enable the identification of distinct populations in specific areas, offering valuable information on geographic distribution, biological characteristics, population genetic structures over time and assessments of reproductive isolation [26].

Although the genetic diversity of mosquitoes, especially Ae. aegypti, has been extensively studied globally [10, 27,28,29,30,31,32,33,34,35], limited information is available on the distribution and genetic diversity of this species in Iran [36,37,38,39,40]. Hence, the aim of the present study was to investigate the origin, genetic diversity and phylogeny of Ae. aegypti collected from southern Iran. The findings of this study are crucial for comprehending and effectively managing the Ae. aegypti population in Iran and will facilitate the development of better recognition and control strategies against this species in Iran.

Methods

Study area

Bandar Abbas City, the capital of Hormozgan province, is located on the southern coast of Iran, on the Persian Gulf (56.15–56.42°E and 27.13–27.27°N). In terms of weather conditions, this city has a scorching and humid climate.

Mosquito collection and rearing

Eggs of Ae. aegypti were collected in sticky ovitraps between May and July 2022 in 11 urban localities within Bandar Abbas City (Fig. 1). Details on the geographical properties of these egg collection sites and the respective egg counts are presented in Table 1.

Fig. 1
figure 1

Geographical locations of collection sites. Map was constructed using arc-GIS software, version 10.8 (ESRI, Redlands, CA, USA)

Table 1 Geographic characteristics of Aedes aegypti egg collection sites detailing the number of eggs collected at each location

The ovitraps were placed indoors and outdoors in shaded areas to avoid direct sunlight and rain. At each study site, 10 ovitraps were deployed for sampling; at 4-day intervals all ovitraps were replaced with new ones, and the collected ovitraps were transferred to the mosquito insectary at the Hormozgan Medical Sciences, Iran. Larvae emerging from the collected eggs were fed with dry fish food and kept at 26 ± 2 °C and 65% ± 5% relative humidity under a light:dark cycle of 12:12 h. The reared mosquitoes were identified using available morphological keys [41,42,43] and then stored in a microtube containing ethanol at − 20 °C for molecular tests.

Molecular tests

The Collins extraction method was utilized to extract DNA from the stored Ae. aegypti mosquitoes [44]. A total of 1465 eggs were collected in this study and reared in the laboratory, and three egg samples from each site were randomly selected for PCR analysis, with the exception of one site where no samples were collected. Thus, a total of 30 samples were included in the PCR analysis. For detection of the origin of the Ae. Aegypti, we used a 721-bp region of the mitochondrial DNA-encoded cytochrome c oxidase subunit I (mtDNA-COI) gene amplified in a thermal cycler using forward primers (GGTCAACAAATCATAAAGATATTGG) and reverse primers (TAAACTTCAGGGTGACCAAAAAATCA) [45].

The PCR reaction was carried out in a total reaction volume of 20 μl (4 mM of MgCl2, 1.5 μM of forward primer, 1.5 of reverse primer, 2 mM buffer, 150 mM of each dNTP, 1 U Taq DNA polymerase, 40 ng of DNA and deionized water to correct volume). The thermal conditions for the PCR reaction consisted of an initial denaturation at 95 °C for 10 min; followed by 30 cycles of amplification (denaturation at 95 °C for 1 min, annealing at 54 °C for 1 min and expansion at 70 °C for 1 min; with a final extension at 70 °C for 10 min [46].

Genetic analysis

Products from the PCR analysis were separated by gel electrophoresis and the bands observed in a gel documentation system. A 100-bp DNA ladder was used as the molecular weight marker. One high-quality 721-bp mtDNA-COI gene fragment from each collection site (10 samples in total) was sequenced by the Livogen Pharmed Company, Tehran, Iran. The sequences were aligned with Clustal W [47], and then edited using the BioEdit sequence analysis tool [48].

The number of haplotypes was computed using the DNAsp software package [49]. Other parameters, including haplotype diversity (Hd), nucleotide diversity (p), the average number of pairwise nucleotide differences and the number of synonymous and non-synonymous mutations, were also calculated using DNAsp software [50,51,52].

Phylogenetic relationships were explored using MEGA6 and BioEdit software [53, 54]. Ultimately, the sequences were recorded in the GenBank database (NCBI).

Population expansion

To examine neutral mutation, we determined Tajima’s D, Fu and Li’s D+ and F+ and R2 statistics using DNAsp software [49, 51]. Tajima's D was calculated based on the number of different sites. Fu’s Fs statistic was used to assess the demographic stability [55].

Results

The basic local alignment search tool (BLAST) analysis [56] confirmed the accurate identification of samples as Ae. aegypti, with 100% similarity to GenBank sequences. The PCR product was first sequenced and then edited, following which the edited sequences were deposited in the GenBank under accession numbers OQ997236, OQ997237, OQ997238, OQ997239, OQ997240, OR398783, OR398784, OR398785, OR398786 and OR398787.

Overall, of the 10 samples from Iran in the present study and the 19 sequences retrieved from GenBank, the sequencing study revealed only two haplotypes, with a haplotype diversity and haplotype diversity variance of 0.502 and 0.00157, respectively. Among the 604 nucleotides examined, only one site was found to be non-synonymous, with an average number of pairwise nucleotides and average number of nucleotide differences of 0.502 and 0.50246, respectively.

Nucleotide diversity of the Ae. aegypti sequences based on the COΙ gene was found to possess a low value of 0.000832, and the number of segregation sites was 1 (Table 2).

Table 2 Genetic variability indices for the Ae. aegypti samples from southern Iran

The results from the pairwise nucleotide differences test indicated a single polymorphic (segregating) site. Harpending’s raggedness statistic (R2: 0.2525) was not significant (P > 0.05) across any of the populations of Ae. aegypti. The average values for Fu and Li’s D+ (0.59850) and F+ (0.98452) statistic and for and Fu’s F (1.629) statistic were positive. Fu and Li’s test values were not significant. Strobeck’s S statistic value was 0.487 and Tajima’s D value was 1.53395; both results were not statistically significant (P > 0.10) (Table 3).

Table 3 Population expansion indices for the Ae. aegypti samples from southern Iran

Substitution pattern and rates were estimated under the Tamura-Nei model (+G). The gamma parameter was used to model evolutionary rate differences among sites (5 categories, [+G]). Mean evolutionary rates in these categories were 0.00, 0.00, 0.01, 0.26 and 4.73 substitutions per site. The A, T/U, C and G nucleotide frequencies were 28.21%, 38.74%, 17.38% and 15.66%, respectively.

The phylogeny tree was constructed using the same 29 nucleotide sequences, encompassing 604 nucleotides, from Ae. aegypti samples collected in Iran and other countries, based on the mtDNA-COI gene. This tree delineates two primary clades. The first clade includes sequences from samples collected in France, Peru, Uruguay, Puerto Rico, Guatemala, Vietnam, India, Canada, Malaysia, USA, England, Germany, Sri Lanka, Mexico, Laos and Cambodia. Clade 2 includes sequences from samples colleced in Saudi Arabia and Pakistan and Bandar Abbas City in Iran (Fig. 2).

Fig. 2
figure 2

Molecular phylogenetic analysis of the mtDNA-COI gene of Aedes aegypti samples and outgroup (Culiseta longiareolata) by the maximum likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood (− 1071.43) is shown. The percentage of trees in which the associated taxa clustered together is shown above the branches. The tree is drawn to scale, with branch lengths corresponding to the number of substitutions per site. MtDNA-COI, Mitochondrial DNA-encoded cytochrome c oxidase subunit I gene

The results indicate a similarity between the mtDNA-COI sequences of Ae. aegypti in Hormozgan Province, Iran and those found in Pakistan and Saudi Arabia, as depicted in Fig. 2.

Discussion

Over the last decade, there has been a significant rise in the prevalence of major arbovirus diseases, such as dengue and Zika. The establishment of Ae. aegypti, the primary vector of these diseases, in the southern regions of Iran, spurred our investigation into the population history of Ae. aegypti in Iran. Given that the mtDNA marker is a reliable indicator for Ae. aegypti, we decided to use COI DNA sequencing data in our study. This gene is extensively employed for the detection of hereditary diversity various mosquito species, including Ae. aegypti, Aedes vexans, Aedes. caspius, Anopheles gambiae and Aedes albopictus [57, 58]. The results of the present study revealed notably low genetic diversity among the Ae. aegypti populations in Iran.

Specifically, our results reveal the presence of two haplotypes that exhibit low diversity (Hd: 0.502) and low nucleotide diversity (π: 0.00083). Generally, low haplotype diversity suggests that the species under study—in this case Ae. aegypti—either is not native to the area or has emerged recently [59]. A study in Honduras by Escobar et al. highlighted uniformly low parameters of Ae. aegypti genetic diversity, which corroborate the findings of our investigation [1]. On the contrary, the genetic diversity within the Ae. aegypti population in Africa stands notably high, strongly suggesting that the African continent is likely Ae. aegypti’s place of origin [1, 32]. Comparative assessments have revealed that the genetic diversity of Ae. aegypti is lower across all other continents, including Asia, when compared with Africa, implying a subsequent colonization of these continents [32]. Thus, our findings substantiate earlier research outcomes.

Between 1947 and 1970, the insecticide dichlorodiphenyltrichloroethane (DDT) was extensively used in the USA against mosquitoes, specifically targeting Ae. aegypti. However, 10 years following the eradication of Ae. aegypti, this mosquito was reintroduced into the region, leading to a bottleneck effect within the Ae. aegypti population and causing a reduction in their genetic diversity [60].

Changes in host frequency and breeding places among Ae. aegypti mosquitoes could potentially further diminish the genetic diversity within populations in the region [58]. In 2018, Joyce et al. collected 84 mosquitoes from various regions across El Salvador and sequenced the COI gene. Their findings revealed an overall haplotype diversity of 0.610 and a nucleotide diversity of 0.016 [61]. Similarly, a study conducted in Panama on 122 mosquitoes from 10 regions reported a nucleotide diversity, haplotype diversity and haplotype diversity of 0.0096, 13 and 0.766, respectively [62]. The results of these two earlier studies indicate a relatively higher genetic diversity within Ae. aegypti mosquito populations than was observed in our study, suggesting that it is likely that Ae. aegypti has become only recently established in Iran.

The findings of a number of earlier studies using mitochondrial gene markers in Ae. aegypti differ from the findings of the present investigation in that the former indicate moderate to higher genetic diversity within their study population. Nonetheless, research carried out across the Asian continent [63,64,65,66,67,68,69] indicates a lower genetic diversity in Ae. aegypti mosquitoes, consistent with our study outcomes.

This study shows a notably low haplotype diversity within the studied Ae. aegypti population, again suggesting the recent establishment of this species in the study area or a limited application of insecticides targeting Ae. aegypti [70]. In contrast, Darlina et al. reported a significantly high haplotype diversity in an Ae. aegypti population, likely attributable to long-term exposure to insecticides, leading to a high nucleotide mutation rate in the studied population [71]. Such increases in nucleotide mutation rate are generally associated with an increase in resistance within the studied Ae. aegypti population [72], possibly linked to extensive use of different groups of insecticides in mosquito control efforts [73]. For example, in regions like Malaysia, the widespread use of synthetic insecticides may be responsible for increases in these types of mutations within mosquito populations [74]. The predictable consequence of this trend is the potential challenge that will need to be met in terms of effectively managing mosquito populations, specifically those of Ae. Aegypti, in the future.

A phylogeny tree with two primary branches was constructed using 29 sequences obtained from Ae. aegypti samples collected in Iran and various other countries. Samples from Iran, Saudi Arabia and Pakistan clustered within one branch while samples from various countries located on four continents, including France, Peru, Uruguay, Puerto Rico, Guatemala, Vietnam, India, Canada, Malaysia, USA, England, Germany, Sri Lanka, Mexico, Laos and Cambodia, were placed on a separate branch. Consequently, our findings indicate a genetic similarity between the Iranian Ae. aegypti population and Ae. aegypti samples from Saudi Arabia and Pakistan, suggesting a probable entry of this mosquito into Iran from these countries.

All specimens of Ae. aegypti included in this study were placed on the two branches of the phylogeny tree, all the samples used in this study were similar to specimens from other countries, especially Saudi Arabia and Pakistan. Two studies conducted on Aedes mosquito populations in India and Thailand reported results exactly the same as our findings, namely that the genetic diversity of Ae. aegypti is low across the globe. Taken together, these results suggest that the species' limited genetic diversity may stem from the resemblance of their habitats. This similarity in genetic makeup across habitats might imply recurrent gene flow. However, there is little evidence to support habitat-related genetic diversity [75].

The ratios of G + C and A + T DNA can vary significantly among organisms, and this variation in A + T or G + C content appears to be influenced by mutation pressure, leading to alterations in these nucleotide combinations. Such changes in G + C and A + T content are often associated with substitutions occurring at different positions within codons [76]. Our nucleotide composition analysis in Ae. aegypti showed that the presence of the A + T combination was 67%. It has been shown that a relatively high presence of the A + T combination within a species reduces the synonymous position and influences the percentage of amino acid substitutions [76, 77]. Our study demonstrated a low number of synonymous positions owing to the high presence (67%) of the A + T combination in the Ae. aegypti population, consistent with previous research [77]. The results of the neutral mutation test on the population of Ae. aegypti mosquitoes showed that there has been no population expansion or selection in southern Iran [78]. The outcomes of the neutral mutation test applied to the Ae. aegypti mosquito population in southern Iran also indicated no signs of population expansion or selection [64].

Finally, this study confirms by molecular methods that the studied Ae. aegypti population exhibits low genetic diversity and that it is highly probable to have entered into southern Iran from Saudi Arabia or Pakistan. To comprehensively understand genetic diversity and analyze gene flow within confined populations of this species, additional mitochondrial genetic markers are imperative. The factors contributing to genetic variation in Ae. aegypti could significantly impact its vectorial capacity and competence [65].

Conclusions

Based on our findings of a low genetic diversity in an Iranian Ae. aegypti population, we suggest that this species has been recently established in the southern region of the country. Given the potential impact of genetic variation on the vector's competence for arboviruses, particularly DENV, further studies should be carried out in this field. Our results also suggest that Ae. aegypti populations might have entered Iran from Saudi Arabia or Pakistan through transportation associated with international trade. Hence, this possibility should be addressed by the Ministry of Health authorities to prevent the vector's spread to other regions of Iran in the future. Further studies on the genetic diversity of Ae. aegypti could significantly contribute to advancing our comprehension of population dynamics, biology and effective management strategies.

Availability of data and materials

The data used to support the findings of this study are included within the paper.

Abbreviations

BLAST:

Basic local alignment search tool

CHIKV:

Chikungunya virus

DENV:

Dengue virus

mtDNA-COI:

Mitochondrial DNA-encoded cytochrome c oxidase subunit I gene

WNV:

West Nile virus

YFV:

Yellow fever virus

References

  1. Escobar D, Ortiz B, Urrutia O, Fontecha G. Genetic diversity among four populations of Aedes aegypti (Diptera: Culicidae) from Honduras as revealed by mitochondrial DNA cytochrome oxidase I. Pathogens. 2022;11:620.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Azizi K, Dorzaban H, Soltani A, Alipour H, Jaberhashemi SA, Salehi-Vaziri M, et al. Monitoring of dengue virus in field-caught Aedes species (Diptera: Culicidae) by molecular method, from 2016 to 2017 in Southern Iran. J Health Sci Surveill Syst. 2023;11:77–83.

    Google Scholar 

  3. Paksa A, Vahedi M, Yousefi S, Saberi N, Rahimi S, Amin M. Biodiversity of mosquitoes (Diptera: Culicidae), vectors of important arboviral diseases at different altitudes in the central part of Iran. Turk J Zool. 2023;47:111–9.

    Article  CAS  Google Scholar 

  4. Paksa A, Sedaghat MM, Vatandoost H, Yaghoobi-Ershadi MR, Moosa-Kazemi SH, Hazratian T, et al. Biodiversity of mosquitoes (Diptera: Culicidae) with emphasis on potential arbovirus vectors in East Azerbaijan province, northwestern Iran. J Arthropod Borne Dis. 2019;13:62.

    PubMed  PubMed Central  Google Scholar 

  5. Espinal MA, Andrus JK, Jauregui B, Waterman SH, Morens DM, Santos JI, et al. Emerging and reemerging Aedes-transmitted arbovirus infections in the region of the Americas: implications for health policy. Am J Public Health. 2019;109:387–92.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Zambrano LI, Rodriguez E, Espinoza-Salvado IA, Rodríguez-Morales AJ. Dengue in Honduras and the Americas: the epidemics are back! Travel Med Infect Sci. 2019;31:101456.

    Article  Google Scholar 

  7. Powell JR, Gloria-Soria A, Kotsakiozi P. Recent history of Aedes aegypti: vector genomics and epidemiology records. Bioscience. 2018;68:854–60.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Mattingly P. Taxonomy of Aedes aegypti and related species. Bull World Health Organ. 1967;36:552.

    CAS  PubMed  PubMed Central  Google Scholar 

  9. Mattingly P. Genetical aspects of the Aedes aegypti problem: I.—taxonomy and bionomics. Ann Trop Med Parasitol. 1957;51:392–408.

    Article  CAS  PubMed  Google Scholar 

  10. Powell JR, Tabachnick WJ. History of domestication and spread of Aedes aegypti-a review. Mem Inst Oswaldo Cruz. 2013;108:11–7.

    Article  PubMed  PubMed Central  Google Scholar 

  11. McBride CS, Baier F, Omondi AB, Spitzer SA, Lutomiah J, Sang R, et al. Evolution of mosquito preference for humans linked to an odorant receptor. Nature. 2014;515:222–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Heydari M, Metanat M, Rouzbeh-Far M-A, Tabatabaei SM, Rakhshani M, Sepehri-Rad N, et al. Dengue fever as an emerging infection in southeast Iran. Am J Trop Med Hyg. 2018;98:1469.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Ziyaeyan M, Behzadi MA, Leyva-Grado VH, Azizi K, Pouladfar G, Dorzaban H, et al. Widespread circulation of West Nile virus, but not Zika virus in southern Iran. PLoS Negl Trop Dis. 2018;12:e0007022.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Bakhshi H, Mousson L, Moutailler S, Vazeille M, Piorkowski G, Zakeri S, et al. Detection of arboviruses in mosquitoes: evidence of circulation of chikungunya virus in Iran. PLoS Negl Trop Dis. 2020;14:e0008135.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Vasmehjani AA, Rezaei F, Farahmand M, Mokhtari-Azad T, Yaghoobi-Ershadi MR, Keshavarz M, et al. Epidemiological evidence of mosquito-borne viruses among persons and vectors in Iran: a study from North to South. Virol Sin. 2022;37:149.

    Article  Google Scholar 

  16. Moutailler S, Yousfi L, Mousson L, Devillers E, Vazeille M, Vega-Rúa A, et al. A new high-throughput tool to screen mosquito-borne viruses in Zika virus endemic/epidemic areas. Viruses. 2019;11:904.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Naficy K, Saidi S. Serological survey on viral antibodies in Iran. Trop Geogr Med. 1970;22:183–8.

    CAS  PubMed  Google Scholar 

  18. Saidi RTS, Javadian E, Nadim A, Seedi-Rashti M. The distribution and prevalence of human infection with phlebotomus fever group viruses in Iran. Iran J Public Health. 1976;5:1–7.

    Google Scholar 

  19. Sharifi Z, Shooshtari MM, Talebian A. A study of West Nile virus infection in Iranian blood donors. Arch Iran Med. 2010;13:1–4.

    PubMed  Google Scholar 

  20. Ahmadnejad F, Otarod V, Fallah M, Lowenski S, Sedighi-Moghaddam R, Zavareh A, et al. Spread of West Nile virus in Iran: a cross-sectional serosurvey in equines, 2008–2009. Epidemiol Infect. 2011;139:1587–93.

    Article  CAS  PubMed  Google Scholar 

  21. Bagheri M, Terenius O, Oshaghi MA, Motazakker M, Asgari S, Dabiri F, et al. West Nile virus in mosquitoes of Iranian wetlands. Vector-Borne Zoonot Dis. 2015;15:750–4.

    Article  Google Scholar 

  22. Shahhosseini N, Chinikar S, Moosa-Kazemi SH, Sedaghat MM, Kayedi MH, Lühken R, et al. West Nile Virus lineage-2 in Culex specimens from Iran. Trop Med Int Health. 2017;22:1343–9.

    Article  CAS  PubMed  Google Scholar 

  23. Guillemaud T, Beaumont MA, Ciosi M, Cornuet J-M, Estoup A. Inferring introduction routes of invasive species using approximate Bayesian computation on microsatellite data. Heredity. 2010;104:88–99.

    Article  CAS  PubMed  Google Scholar 

  24. Maynard AJ, Ambrose L, Cooper RD, Chow WK, Davis JB, Muzari MO, et al. Tiger on the prowl: invasion history and spatio-temporal genetic structure of the Asian tiger mosquito Aedes albopictus (Skuse 1894) in the Indo-Pacific. PLoS Negl Trop Dis. 2017;11:e0005546.

    Article  PubMed  PubMed Central  Google Scholar 

  25. Paupy C, Chantha N, Huber K, Lecoz N, Reynes J-M, Rodhain F, et al. Influence of breeding sites features on genetic differentiation of Aedes aegypti populations analyzed on a local scale in Phnom Penh Municipality of Cambodia. Am J Trop Med Hyg. 2004;71:73–81.

    Article  PubMed  Google Scholar 

  26. Hendry AP, Day T. Population structure attributable to reproductive time: isolation by time and adaptation by time. Mol Ecol. 2005;14:901–16.

    Article  CAS  PubMed  Google Scholar 

  27. Tabachnick WJ, Powell JR. A world-wide survey of genetic variation in the yellow fever mosquito, Aedes aegypti. Genet Res. 1979;34:215–29.

    Article  CAS  PubMed  Google Scholar 

  28. Tabachnick WJ, Munstermann LE, Powell JR. Genetic distinctness of sympatric forms of Aedes aegypti in East Africa. Evolution. 1979;33:287–95.

    Article  PubMed  Google Scholar 

  29. Brown JE, McBride CS, Johnson P, Ritchie S, Paupy C, Bossin H, et al. Worldwide patterns of genetic differentiation imply multiple ‘domestications’ of Aedes aegypti, a major vector of human diseases. Proc R Soc B Biol Sci. 2011;278:2446–54.

    Article  Google Scholar 

  30. Gloria-Soria A, Brown JE, Kramer V, Hardstone Yoshimizu M, Powell JR. Origin of the dengue fever mosquito, Aedes aegypti, in California. PLoS Negl Trop Dis. 2014;8:e3029.

    Article  PubMed  PubMed Central  Google Scholar 

  31. Brown JE, Scholte E-J, Dik M, Den Hartog W, Beeuwkes J, Powell JR. Aedes aegypti mosquitoes imported into the Netherlands, 2010. Emerg Infect Dis. 2011;17:2335.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Bennett KL, Shija F, Linton YM, Misinzo G, Kaddumukasa M, Djouaka R, et al. Historical environmental change in Africa drives divergence and admixture of Aedes aegypti mosquitoes: a precursor to successful worldwide colonization? Mol Ecol. 2016;25:4337–54.

    Article  PubMed  Google Scholar 

  33. Li M, Yang T, Kandul NP, Bui M, Gamez S, Raban R, et al. Development of a confinable gene drive system in the human disease vector Aedes aegypti. Elife. 2020;9:e51701.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Bennett KL, McMillan WO, Loaiza JR. The genomic signal of local environmental adaptation in Aedes aegypti mosquitoes. Evol Appl. 2021;14:1301–13.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Gloria-Soria A, Lima A, Lovin DD, Cunningham JM, Severson DW, Powell JR. Origin of a high-latitude population of Aedes aegypti in Washington, DC. Am J Trop Med Hyg. 2018;98:445.

    Article  PubMed  Google Scholar 

  36. Elnour MAB, Moustafa MAM, Khogali R, Azrag RS, Alanazi AD, Kheir A, et al. Distinct haplotypes and free movement of Aedes aegypti in Port Sudan, Sudan. J Appl Entomol. 2020;144:817–23.

    Article  CAS  Google Scholar 

  37. Elnour M-AB, Gloria-Soria A, Azrag RS, Alkhaibari AM, Powell JR, Salim B. Population genetic analysis of Aedes aegypti mosquitoes from Sudan revealed recent independent colonization events by the two subspecies. Front Genet. 2022;13:825652.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Öztürk M, Akiner MM. Molecular phylogenetics of Aedes aegypti (L., 1762)(Diptera: Culicidae) in Eastern Black Sea area of Turkey and possible relations with the Caucasian invasion. Turk J Zool. 2023;47:155–69.

    Article  Google Scholar 

  39. Abuelmaali SA, Jamaluddin JAF, Noaman K, Allam M, Abushama HM, Elnaiem DE, et al. Distribution and genetic diversity of Aedes aegypti subspecies across the Sahelian Belt in Sudan. Pathogens. 2021;10:78.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Abuelmaali SA, Jamaluddin JAF, Allam M, Abushama HM, Elnaiem DE, Noaman K, et al. Genetic polymorphism and phylogenetics of Aedes aegypti from Sudan based on ND4 mitochondrial gene variations. Insects. 2022;13:1144.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Silver JB. Mosquito ecology: field sampling methods. Berlin: Springer Science & Business Media; 2007.

    Google Scholar 

  42. Azari-Hamidian S, Harbach RE. Keys to the adult females and fourth-instar larvae of the mosquitoes of Iran (Diptera: Culicidae). Zootaxa. 2009;2078:1–33.

    Article  Google Scholar 

  43. Rueda LM. Pictorial keys for the identification of mosquitoes (Diptera: Culicidae) associated with dengue virus transmission. Zootaxa. 2004;589:1–60.

    Article  Google Scholar 

  44. Collins FH, Mendez MA, Rasmussen MO, Mehaffey PC, Besansky NJ, Finnerty V. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. Am J Trop Med Hyg. 1987;37:37–41.

    Article  CAS  PubMed  Google Scholar 

  45. Hickey DA, Mitchell A, Sperling FA. Higher-level phylogeny of mosquitoes (Diptera: Culicidae): mtDNA data support a derived placement for Toxorhynchites. Insect Syst Evol. 2002;33:163–74.

    Article  Google Scholar 

  46. Chaiphongpachara T, Changbunjong T, Laojun S, Nutepsu T, Suwandittakul N, Kuntawong K, et al. Mitochondrial DNA barcoding of mosquito species (Diptera: Culicidae) in Thailand. PLoS ONE. 2022;17:e0275090.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–80.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8.

  49. Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25:1451–2.

    Article  CAS  PubMed  Google Scholar 

  50. Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, et al. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol Biol Evol. 2017;34:3299–302.

    Article  CAS  PubMed  Google Scholar 

  51. Tajima F. Evolutionary relationship of DNA sequences in finite populations. Genetics. 1983;105:437–60.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–25.

    CAS  PubMed  Google Scholar 

  53. Stecher G, Tamura K, Kumar S. Molecular evolutionary genetics analysis (MEGA) for macOS. Mol Biol Evol. 2020;37:1237–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38:3022–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. Ramos-Onsins SE, Rozas J. Statistical properties of new neutrality tests against population growth. Mol Biol Evol. 2002;19:2092–100.

    Article  CAS  PubMed  Google Scholar 

  56. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.

    Article  CAS  PubMed  Google Scholar 

  57. Besansky NJ, Lehmann T, Fahey GT, Fontenille D, Braack LE, Hawley WA, et al. Patterns of mitochondrial variation within and between African malaria vectors, Anopheles gambiae and An. arabiensis, suggest extensive gene flow. Genetics. 1997;147:1817–28.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  58. Birungi J, Munstermann LE. Genetic structure of Aedes albopictus (Diptera: Culicidae) populations based on mitochondrial ND5 sequences: evidence for an independent invasion into Brazil and United States. Ann Entomol Soc Am. 2002;95:125–32.

    Article  CAS  Google Scholar 

  59. Hartl DL, Clark AG, Clark AG. Principles of population genetics, vol. 116. Sunderland: Sinauer Associates; 1997.

    Google Scholar 

  60. Sherpa S, Rioux D, Goindin D, Fouque F, François O, Despres L. At the origin of a worldwide invasion: unraveling the genetic makeup of the Caribbean bridgehead populations of the dengue vector Aedes aegypti. Genome Biol Evol. 2018;10:56–71.

    Article  PubMed  Google Scholar 

  61. Joyce AL, Torres MM, Torres R, Moreno M. Genetic variability of the Aedes aegypti (Diptera: Culicidae) mosquito in El Salvador, vector of dengue, yellow fever, chikungunya and Zika. Parasit Vectors. 2018;11:1–14.

    Article  Google Scholar 

  62. Eskildsen GA, Rovira JR, Smith O, Miller MJ, Bennett KL, McMillan WO, et al. Maternal invasion history of Aedes aegypti and Aedes albopictus into the Isthmus of Panama: implications for the control of emergent viral disease agents. PLoS ONE. 2018;13:e0194874.

    Article  PubMed  PubMed Central  Google Scholar 

  63. Khater EI, Baig F, Kamal HA, Powell JR, Saleh AA. Molecular phylogenetics and population genetics of the dengue vector Aedes aegypti from the Arabian Peninsula. J Med Entomol. 2021;58:2161–76.

    Article  CAS  PubMed  Google Scholar 

  64. Dharmarathne H, Weerasena O, Perera K, Galhena G. Genetic characterization of Aedes aegypti (Diptera: Culicidae) in Sri Lanka based on COI gene. J Vector Borne Dis. 2020;57:153.

    Article  CAS  PubMed  Google Scholar 

  65. Kumar MS, Kalimuthu M, Selvam A, Mathivanan A, Paramasivan R, Kumar A, et al. Genetic structure and connectivity among Aedes aegypti populations within Madurai city in Southern India. Infect Genet Evol. 2021;95:105031.

    Article  CAS  PubMed  Google Scholar 

  66. Lv R, Zhu C, Wang C, Ai L, Lv H, Zhang B, et al. Genetic diversity and population structure of Aedes aegypti after massive vector control for dengue fever prevention in Yunnan border areas. Sci Rep. 2020;10:12731.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  67. Shi Q-M, Zhang H-D, Wang G, Guo X-X, Xing D, Dong Y-D, et al. The genetic diversity and population structure of domestic Aedes aegypti (Diptera: Culicidae) in Yunnan Province, southwestern China. Parasit Vectors. 2017;10:1–11.

    Article  Google Scholar 

  68. Yugavathy N, Kim-Sung L, Joanne S, Vythilingam I. Genetic variation of the mitochondrial genes, CO1 and ND5, in Aedes aegypti from various regions of peninsular Malaysia. Trop Biomed. 2016;33:543–60.

    CAS  PubMed  Google Scholar 

  69. Duong C-V, Kang J-H, Nguyen V-V, Bae Y-J. Genetic diversity and population structure of the Asian tiger mosquito (Aedes albopictus) in Vietnam: evidence for genetic differentiation by climate region. Genes. 2021;12:1579.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  70. Naim DM, Kamal NZM, Mahboob S. Population structure and genetic diversity of Aedes aegypti and Aedes albopictus in Penang as revealed by mitochondrial DNA cytochrome oxidase I. Saudi J Biol Sci. 2020;27:953–67.

    Article  Google Scholar 

  71. Vandewoestijne S, Baguette M, Brakefield PM, Saccheri I. Phylogeography of Aglais urticae (Lepidoptera) based on DNA sequences of the mitochondrial COI gene and control region. Mol Phylogenet Evol. 2004;31:630–46.

    Article  CAS  PubMed  Google Scholar 

  72. Overgaard H. Malaria mosquito resistance to agricultural insecticides: risk area mapping in Thailand. (IWMI Research Report 103). Colombo: International Water Management Institute (IWMI); 2006.

  73. Wan-Norafikah O, Nazni W, Noramiza S, Shafa’ar-Ko’Ohar S, Heah S, Nor-Azlina A, et al. Distribution of Aedes mosquitoes in three selected localities in Malaysia. Sains Malaysiana. 2012;41:1309–13.

    Google Scholar 

  74. Hashim NA. Population abundance, distribution, forecasting models and breeding habitat ecology of dengue vector in Penang Island. Penang: Universiti Sains Malaysia; 2013.

    Google Scholar 

  75. Xia S, Cosme LV, Lutomiah J, Sang R, Ngangue MF, Rahola N, et al. Genetic structure of the mosquito Aedes aegypti in local forest and domestic habitats in Gabon and Kenya. Parasit Vectors. 2020;13:1–13.

    Article  Google Scholar 

  76. Jukes TH, Bhushan V. Silent nucleotide substitutions and G+ C content of some mitochondrial and bacterial genes. J Mol Evol. 1986;24:39–44.

    Article  CAS  PubMed  Google Scholar 

  77. Chung C-L. A simple method for determining the identity of the eggs of Aedes aegypti (Linnaeus) and Aedes albopictus (Skuse) by dissection (Diptera: Culicidae). Chin J Entomol. 1997;17:86–91.

    Google Scholar 

  78. Lewter JA, Szalanski AL, Nagoshi RN, Meagher RL Jr, Owens CB, Luttrell RG. Genetic variation within and between strains of the fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae). Fla Entomol. 2006;89:63–8.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

The authors would like to thank the Department of Biology and Control of Disease Vectors, School of Health, Hormozgan University of Medical Sciences, Bandar Abbas, Iran for providing the mosquito laboratory facilities.

Funding

This study was funded by two grants, one from the Shiraz University of Medical Sciences (No. 26334) and another from the Hormozgan University of Medical Sciences (No. 4000458).

Author information

Authors and Affiliations

Authors

Contributions

AP analyzed and interpreted the data and drafted the manuscript. KA analyzed the data. SY and SD performed laboratory experiments. SS reviewed and edited the manuscript. AS conceived and designed the study and reviewed the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Alireza Sanei-Dehkordi.

Ethics declarations

Ethics approval and consent to participate

This study was approved by the ethical committee of Shiraz University of Medical Sciences (IR.SUMS.SCHEANUT.REC.1401.113).

Consent for publication

All authors consent to publication.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Paksa, A., Azizi, K., Yousefi, S. et al. First report on the molecular phylogenetics and population genetics of Aedes aegypti in Iran. Parasites Vectors 17, 49 (2024). https://0-doi-org.brum.beds.ac.uk/10.1186/s13071-024-06138-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s13071-024-06138-3

Keywords