Table 1 Oligonucleotide primer sequences used for Nested PCR in this research
Name | Sequences (5'-3') | Description |
|---|---|---|
OP-F | TCTGGAATGGCTGAAGAAGACG | Forward primer for the actin gene of T. vaginalis in the first stage |
OP-R | CAGGGTACATCGTATTGGTC | Reverse primer for the actin gene of T. vaginalis in the first stage |
IP-F | CAGACACTCGTTATCG | Forward primer for the actin gene of T. vaginalis in the second stage |
IP-R | CGGTGAACGATGGATG | Reverse primer for the actin gene of T. vaginalis in the second stage |