Skip to main content

Advertisement

Table 1 List of primers used in this study

From: Establishment of a stable transfection system for genetic manipulation of Babesia gibsoni

Primer Sequence (5'–3')a
Bg 5′-ef-1α-F (Hind III) GACGGTATCGATAAGCTTCACTGTATAACGGATGAAGGT
Bg 5′-ef-1α-R (Hind III) CACCATGATATCAAGCTTTTTGGTAAAGGTTGACGATA
GFP-F (EcoR V) ATCGATAAGCTTGATATCATGGTGAGCAAGGGCGA
GFP-R (EcoR V) CTGCAGGAATTCGATATCTTACTTGTACAGCTCGTCCATG
Bb 3′-rap-F (Sma I) GAATTCCTGCAGCCCGGGGATGAGATGCGTTTATAATGGC
Bb 3′-rap-R (Sma I) ACTAGTGGATCCCCCGGGCCTACGAACGATATGTCAAAGAG
Bg 5′-actin-F (Hind III) GACGGTATCGATAAGCTTCCAGTAAAAAGTGACTACCATA
Bg 5′-actin-R (Hind III) AACCATGATATCAAGCTTTTTGATAACGTAATAGCTCTGTA
hDHFR-F (EcoR V) ATCGATAAGCTTGATATCATGGTTGGTTCGCTAAAC
hDHFR-R (EcoR V) CTGCAGGAATTCGATATCTTAATCATTCTTCTCATATACTTC
Bg 3′-ef-1α-F (Sma I) GAATTCCTGCAGCCCGGGAGCTGATTATTTCGTGTTAACT
Bg 3′-ef-1α-R (Sma I) ACTAGTGGATCCCCCGGGGATTGGTAGTATTTGTCGTCAT
EGR-F (Sal I) CCCCCCCTCGAGGTCGACCACTGTATAACGGATGAAGGT
EGR-R (Sal I) CTTATCGATACCGTCGACCCTACGAACGATATGTCAAAGAG
Integ-F TAGCAGCCAAGCGAGATA
Integ-R CAACTTAGATTGATCGGTG
Probe-GFP-F ATGGTGAGCAAGGGCGA
Probe-GFP-R TTACTTGTACAGCTCGTCCATG
Probe-3′-ef-1α-F ATCCCCTGTCTCAATGG
Probe-3′-ef-1α-R GATTGGTAGTATTTGTCGTCA
  1. aRestriction enzyme sites are underlined