Skip to main content

Advertisement

Table 1 LD RPA primers and probe sequences

From: Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assay

Name Sequence (5´-3´) Amplicon length
FP3 ATGGGCCAAAAACCCAAACTTTTCTGGTCCTC 160 bp
RP3 CTCCACCCGACCCTATTTTACACCAACCCCCAGT
P CGCCTCGGAGCCGAT(BHQ1dT)(Tetrahydrofuran)(FAMdT)TGGCATTTTTGGCTATTTTTTGAACGGGAT-phosphate