Table 3 Read numbers of nematode-derived miRNAs detected in serum or plasma from individuals who tested positive for O. volvulus
From: Extracellular Onchocerca-derived small RNAs in host nodules and blood
miRNA | RNA sequence | Precursor coordinates | Uninfected serum (European control) | Infected serum (Cameroon) | Uninfected serum (Ghana) | Infected serum (Ghana) |
|---|---|---|---|---|---|---|
miR-71 | UGAAAGACAUGGGUAGUGAGAC[G]1 | OVOC.OM1b:9907432..9907494:+ | 0 | 43 | 0 | 98 |
lin-4 | UCCCUGAGACCUCUGCUGCGA | OVOC.OM4:5453650..5453708:- | 0 | 32 | 0 | 73 |
miR-100d | AACCCGUAGUUUCGAACAUGUGU | OVOC.OM1a:1762729..1762789:- | 0 | 0 | 121 | 314 |
miR-87-3p | GUGAGCAAAGUUUCAGGUGUUC | OVOC.OM2:17655901..17655965:- | 0 | 0 | 0 | 85 |
miR-100a | UACCCGUAGCUCCGAAUAUGUGU | OVOC.OM1a:1763611..1763671:- | 0 | 0 | 0 | 102 |
bantam-a | UGAGAUCAUUGUGAAAGCUAUU | OVOC.OM2:1211194..1211257:- | 0 | 0 | 223 | 71 |